ID: 1038612255_1038612257

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1038612255 1038612257
Species Human (GRCh38) Human (GRCh38)
Location 8:29068133-29068155 8:29068146-29068168
Sequence CCTTGGGTGCCATCTGCGGGCCG CTGCGGGCCGACCCACACTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 114} {0: 1, 1: 0, 2: 0, 3: 1, 4: 24}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!