ID: 1038612847_1038612857

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1038612847 1038612857
Species Human (GRCh38) Human (GRCh38)
Location 8:29070686-29070708 8:29070729-29070751
Sequence CCCGGCTGGGCCTGACCAGCAGC GAAGTACTGCTTCCCGCCGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 55, 4: 487} {0: 1, 1: 0, 2: 0, 3: 1, 4: 29}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!