ID: 1038632913_1038632922

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1038632913 1038632922
Species Human (GRCh38) Human (GRCh38)
Location 8:29262866-29262888 8:29262890-29262912
Sequence CCCCGCCGCTGACTATAGGGGCG GGCCGCCGGACCCCCCACGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 16} {0: 1, 1: 0, 2: 0, 3: 3, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!