ID: 1038635141_1038635149

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1038635141 1038635149
Species Human (GRCh38) Human (GRCh38)
Location 8:29280311-29280333 8:29280342-29280364
Sequence CCGGGCATGATGATGCACGTCAG CCTACTAAGTAGGCTGAGGAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 80, 3: 4972, 4: 126446}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!