ID: 1038646237_1038646248

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1038646237 1038646248
Species Human (GRCh38) Human (GRCh38)
Location 8:29364899-29364921 8:29364934-29364956
Sequence CCTCCATCCGCCAGAGGTACATG CAGAGGATGGGGCAGAGATCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 4, 3: 63, 4: 464}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!