ID: 1038649941_1038649944

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1038649941 1038649944
Species Human (GRCh38) Human (GRCh38)
Location 8:29393466-29393488 8:29393479-29393501
Sequence CCTTGAATTTCTAAGCAATCATC AGCAATCATCATAGTGGGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 243} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!