ID: 1038729906_1038729907

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1038729906 1038729907
Species Human (GRCh38) Human (GRCh38)
Location 8:30117451-30117473 8:30117467-30117489
Sequence CCAGCTGAGGTTGTCAGTACAAT GTACAATGAAACCAAACTGAAGG
Strand - +
Off-target summary No data {0: 1, 1: 9, 2: 5, 3: 12, 4: 209}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!