ID: 1038789709_1038789715

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1038789709 1038789715
Species Human (GRCh38) Human (GRCh38)
Location 8:30657862-30657884 8:30657882-30657904
Sequence CCCGTGAGGTGGAGGTCACGCTC CTCAGCCTCCCGGGAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 440} {0: 1, 1: 1, 2: 18, 3: 489, 4: 13287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!