ID: 1038808006_1038808015

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1038808006 1038808015
Species Human (GRCh38) Human (GRCh38)
Location 8:30812495-30812517 8:30812519-30812541
Sequence CCCCGGCCCGGGCGCCGCTCCCC CTCCCTCCGCCGCCGTCGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 694} {0: 1, 1: 0, 2: 2, 3: 40, 4: 383}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!