ID: 1038853997_1038853999

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1038853997 1038853999
Species Human (GRCh38) Human (GRCh38)
Location 8:31311156-31311178 8:31311172-31311194
Sequence CCTGATGTATGGCAGAGCTATTC GCTATTCAATAAATGCTGCTGGG
Strand - +
Off-target summary No data {0: 2, 1: 49, 2: 1862, 3: 17326, 4: 12184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!