ID: 1039004705_1039004708

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1039004705 1039004708
Species Human (GRCh38) Human (GRCh38)
Location 8:33021489-33021511 8:33021529-33021551
Sequence CCCTAAAAGTTTTAGTGTTAATT TTTAGTTTGAGAGTTTTGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 28, 4: 324}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!