ID: 1039017700_1039017703

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1039017700 1039017703
Species Human (GRCh38) Human (GRCh38)
Location 8:33170741-33170763 8:33170763-33170785
Sequence CCAGTGTCCACAGGTCATGAAGC CCACTGTTTCATTTTCTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 122} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!