ID: 1039057890_1039057904

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1039057890 1039057904
Species Human (GRCh38) Human (GRCh38)
Location 8:33551123-33551145 8:33551171-33551193
Sequence CCAACCACTGGGGCCAGCCAGGT CTGGACTGCCTGGGGCAAGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 251} {0: 1, 1: 0, 2: 1, 3: 119, 4: 629}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!