ID: 1039135778_1039135783

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1039135778 1039135783
Species Human (GRCh38) Human (GRCh38)
Location 8:34321323-34321345 8:34321367-34321389
Sequence CCCCACTGTGATCCCTGGGATCA ATCTGATTGTTTAAAGTGTGTGG
Strand - +
Off-target summary No data {0: 4, 1: 33, 2: 75, 3: 110, 4: 561}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!