ID: 1039183764_1039183774

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1039183764 1039183774
Species Human (GRCh38) Human (GRCh38)
Location 8:34894130-34894152 8:34894178-34894200
Sequence CCACTCTTAATGCAAGCATGAGA TGGGACTCCTTGGAAAAAACAGG
Strand - +
Off-target summary No data {0: 3, 1: 15, 2: 18, 3: 31, 4: 179}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!