ID: 1039194836_1039194838

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1039194836 1039194838
Species Human (GRCh38) Human (GRCh38)
Location 8:35019575-35019597 8:35019608-35019630
Sequence CCAGGAACTGTGTCAGGGATGTC CTAAGCTGCAGATGCTAACAAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 10, 4: 141}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!