ID: 1039263749_1039263751

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1039263749 1039263751
Species Human (GRCh38) Human (GRCh38)
Location 8:35802268-35802290 8:35802294-35802316
Sequence CCTATTCAAGGAGCAGCAAGGAG AGTGTGAGCGAGAGAATAGTAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 16, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!