ID: 1039275240_1039275244

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1039275240 1039275244
Species Human (GRCh38) Human (GRCh38)
Location 8:35927651-35927673 8:35927678-35927700
Sequence CCACAAGTTCAGGGTTCCTTTCT ATGGAACCTACTGCATGTGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!