ID: 1039311577_1039311593

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1039311577 1039311593
Species Human (GRCh38) Human (GRCh38)
Location 8:36322413-36322435 8:36322459-36322481
Sequence CCCGCCTTCTCCGTGGCCGCCCT CTGCGCAGGTTTCCAAGTAGAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!