ID: 1039384818_1039384819

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1039384818 1039384819
Species Human (GRCh38) Human (GRCh38)
Location 8:37125943-37125965 8:37125966-37125988
Sequence CCAGAATTCTCTCTCTGCGTGGC TCTCTCCGCCATACTCTGCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 10, 4: 138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!