ID: 1039388228_1039388231

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1039388228 1039388231
Species Human (GRCh38) Human (GRCh38)
Location 8:37155614-37155636 8:37155651-37155673
Sequence CCTGAAAACATCCTAACGTCACC CTGTCCCATTAATGATGTTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 31, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!