ID: 1039426878_1039426882

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1039426878 1039426882
Species Human (GRCh38) Human (GRCh38)
Location 8:37493508-37493530 8:37493521-37493543
Sequence CCATTCTGTCACACAGACTCCAG CAGACTCCAGGAGAAGGCGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 458} {0: 1, 1: 0, 2: 2, 3: 35, 4: 295}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!