ID: 1039512809_1039512816

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1039512809 1039512816
Species Human (GRCh38) Human (GRCh38)
Location 8:38105340-38105362 8:38105356-38105378
Sequence CCTTCAGCCTGCCAGGCCCGCGG CCCGCGGCCACCGCCGGCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 247} {0: 1, 1: 0, 2: 6, 3: 52, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!