ID: 1039517445_1039517450

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1039517445 1039517450
Species Human (GRCh38) Human (GRCh38)
Location 8:38145711-38145733 8:38145731-38145753
Sequence CCCCATGCTTCAGAAAATTATTA TTAAGGTTCTTAAACTTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 307} {0: 1, 1: 0, 2: 4, 3: 34, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!