ID: 1039518298_1039518317

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1039518298 1039518317
Species Human (GRCh38) Human (GRCh38)
Location 8:38151091-38151113 8:38151143-38151165
Sequence CCGTTTGTGGGGAGCTTGGGGCG CAGGGCCAGGCGAGGGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 84} {0: 1, 1: 0, 2: 11, 3: 150, 4: 1457}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!