ID: 1039532273_1039532276

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1039532273 1039532276
Species Human (GRCh38) Human (GRCh38)
Location 8:38273829-38273851 8:38273843-38273865
Sequence CCAATGAGTCACCGCAGAATTAA CAGAATTAATTGCTGGAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 76} {0: 1, 1: 0, 2: 1, 3: 24, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!