ID: 1039532448_1039532452

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1039532448 1039532452
Species Human (GRCh38) Human (GRCh38)
Location 8:38275736-38275758 8:38275754-38275776
Sequence CCGAGCAGCAGAGGCGGCCTTCC CTTCCAGTGCAGAGGGAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 196} {0: 1, 1: 0, 2: 3, 3: 18, 4: 222}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!