ID: 1039554216_1039554220

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1039554216 1039554220
Species Human (GRCh38) Human (GRCh38)
Location 8:38465568-38465590 8:38465588-38465610
Sequence CCACTGGGGGTAGGATATGTAAA AAACAAGTCATTAGGGAGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 76} {0: 1, 1: 0, 2: 1, 3: 22, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!