ID: 1039595005_1039595012

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1039595005 1039595012
Species Human (GRCh38) Human (GRCh38)
Location 8:38784119-38784141 8:38784163-38784185
Sequence CCTGTACCAGGTAAGAACGAAGC GAGAGGAGTGGTCCAGCTAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 54} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!