ID: 1039601968_1039601971

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1039601968 1039601971
Species Human (GRCh38) Human (GRCh38)
Location 8:38846867-38846889 8:38846881-38846903
Sequence CCTCCTCAGCAGTGACTCACTTA ACTCACTTAATGACAGATCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 132} {0: 1, 1: 0, 2: 1, 3: 12, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!