ID: 1039617285_1039617298

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1039617285 1039617298
Species Human (GRCh38) Human (GRCh38)
Location 8:38966269-38966291 8:38966297-38966319
Sequence CCTGATAGAATGCAAAGAGGAGG CTTTGGGGATGGGGGGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 239} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!