ID: 1039701075_1039701080

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1039701075 1039701080
Species Human (GRCh38) Human (GRCh38)
Location 8:39962510-39962532 8:39962562-39962584
Sequence CCTTTTGATGCAGGATTTTCTGC TCTCATGACCAGGAAGAATTAGG
Strand - +
Off-target summary No data {0: 10, 1: 73, 2: 99, 3: 273, 4: 638}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!