ID: 1039701077_1039701086

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1039701077 1039701086
Species Human (GRCh38) Human (GRCh38)
Location 8:39962534-39962556 8:39962587-39962609
Sequence CCTCAGCTCAGCGAAATCCAGGA GGTGGACATAGTGAAGGGTGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 24, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!