ID: 1039763683_1039763687

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1039763683 1039763687
Species Human (GRCh38) Human (GRCh38)
Location 8:40606045-40606067 8:40606089-40606111
Sequence CCTTCAGTTTATGTGAGTCCTTA GAAGACAGTGGATACTTGGTTGG
Strand - +
Off-target summary {0: 4, 1: 293, 2: 418, 3: 321, 4: 406} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!