|
Left Crispr |
Right Crispr |
| Crispr ID |
1039792527 |
1039792537 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:40887191-40887213
|
8:40887239-40887261
|
| Sequence |
CCGGTTTTGGCCAGGCACGGTGG |
AACACTTTGGGAGCCTGAGGAGG |
| Strand |
- |
+ |
| Off-target summary |
No data |
{0: 53, 1: 5488, 2: 75459, 3: 160682, 4: 157627} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|