ID: 1039792527_1039792537

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1039792527 1039792537
Species Human (GRCh38) Human (GRCh38)
Location 8:40887191-40887213 8:40887239-40887261
Sequence CCGGTTTTGGCCAGGCACGGTGG AACACTTTGGGAGCCTGAGGAGG
Strand - +
Off-target summary No data {0: 53, 1: 5488, 2: 75459, 3: 160682, 4: 157627}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!