ID: 1039834099_1039834104

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1039834099 1039834104
Species Human (GRCh38) Human (GRCh38)
Location 8:41242515-41242537 8:41242538-41242560
Sequence CCTGAAGACAAAACTCACATAAG TGTTGGGGGCCTCCTAAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 331} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!