ID: 1039838133_1039838141

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1039838133 1039838141
Species Human (GRCh38) Human (GRCh38)
Location 8:41273865-41273887 8:41273913-41273935
Sequence CCTCAATGTGGGCTGGCACCACC TAAAGCAAGGAGAAGAAGGCAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 5, 3: 85, 4: 816}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!