ID: 1039848384_1039848390

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1039848384 1039848390
Species Human (GRCh38) Human (GRCh38)
Location 8:41342308-41342330 8:41342326-41342348
Sequence CCTCACCCCTCAACCCTTTGAAG TGAAGCCACTCATTTGTCCCCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!