ID: 1039856784_1039856795

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1039856784 1039856795
Species Human (GRCh38) Human (GRCh38)
Location 8:41421962-41421984 8:41422014-41422036
Sequence CCGGGCGAGGTGGCGGGCGCCTG GGAGAATGGCGTGAAGCCCAGGG
Strand - +
Off-target summary {0: 561, 1: 13132, 2: 34848, 3: 55996, 4: 114451} {0: 2, 1: 298, 2: 430, 3: 987, 4: 1795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!