ID: 1039856787_1039856795

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1039856787 1039856795
Species Human (GRCh38) Human (GRCh38)
Location 8:41421981-41422003 8:41422014-41422036
Sequence CCTGTAGTCCCAGCTACTCGGGA GGAGAATGGCGTGAAGCCCAGGG
Strand - +
Off-target summary {0: 54379, 1: 173656, 2: 264604, 3: 194654, 4: 115454} {0: 2, 1: 298, 2: 430, 3: 987, 4: 1795}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!