ID: 1039856789_1039856798

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1039856789 1039856798
Species Human (GRCh38) Human (GRCh38)
Location 8:41421989-41422011 8:41422019-41422041
Sequence CCCAGCTACTCGGGAGGCTGAGG ATGGCGTGAAGCCCAGGGGGCGG
Strand - +
Off-target summary No data {0: 2, 1: 287, 2: 292, 3: 309, 4: 622}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!