ID: 1039856791_1039856797

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1039856791 1039856797
Species Human (GRCh38) Human (GRCh38)
Location 8:41421990-41422012 8:41422016-41422038
Sequence CCAGCTACTCGGGAGGCTGAGGC AGAATGGCGTGAAGCCCAGGGGG
Strand - +
Off-target summary No data {0: 2, 1: 337, 2: 432, 3: 637, 4: 1224}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!