ID: 1039866764_1039866768

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1039866764 1039866768
Species Human (GRCh38) Human (GRCh38)
Location 8:41511754-41511776 8:41511776-41511798
Sequence CCATGCGCCAGTCTGTGGAGAGC CAACATCCATGGGCTCTGCAAGG
Strand - +
Off-target summary No data {0: 2, 1: 6, 2: 13, 3: 24, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!