ID: 1039887570_1039887579

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1039887570 1039887579
Species Human (GRCh38) Human (GRCh38)
Location 8:41663907-41663929 8:41663935-41663957
Sequence CCAGGGCGTGGGCGGCGCCCCTG CTGGGAGGCCTGAAGACGAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 402} {0: 1, 1: 0, 2: 2, 3: 16, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!