ID: 1039892892_1039892910

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1039892892 1039892910
Species Human (GRCh38) Human (GRCh38)
Location 8:41696664-41696686 8:41696717-41696739
Sequence CCCGCCACTCACCCTGTATGCAC GGTCTCGGTGGCCGGGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 204} {0: 1, 1: 0, 2: 0, 3: 23, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!