ID: 1039906730_1039906744

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1039906730 1039906744
Species Human (GRCh38) Human (GRCh38)
Location 8:41791832-41791854 8:41791883-41791905
Sequence CCGCTGCCTTCCAGACACCATGG ACCCTTCCAGGCGTTCCTATAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 49, 4: 463} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!