ID: 1039956267_1039956268

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1039956267 1039956268
Species Human (GRCh38) Human (GRCh38)
Location 8:42209332-42209354 8:42209355-42209377
Sequence CCATCAATGGAGGACTGGATAAA GAAAATGCACATATACACCGAGG
Strand - +
Off-target summary {0: 10, 1: 237, 2: 1776, 3: 9121, 4: 18822} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!