ID: 1039996707_1039996720

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1039996707 1039996720
Species Human (GRCh38) Human (GRCh38)
Location 8:42541141-42541163 8:42541178-42541200
Sequence CCCCGCCGAGTCCCACCCCAAGC AGGAGGCGCCCGGCACTCGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 211} {0: 1, 1: 0, 2: 0, 3: 11, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!