ID: 1040032953_1040032969

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1040032953 1040032969
Species Human (GRCh38) Human (GRCh38)
Location 8:42842904-42842926 8:42842946-42842968
Sequence CCGGCCCCAGACCCCACCCGCCC GGCTCCGCCCCCGGCCCCGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 168, 4: 1499} {0: 2, 1: 2, 2: 7, 3: 79, 4: 663}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!