ID: 1040075034_1040075043

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1040075034 1040075043
Species Human (GRCh38) Human (GRCh38)
Location 8:43220549-43220571 8:43220599-43220621
Sequence CCCTGCCCACTCTGTGGAAACAG AGGAAATGGCCATTGTTTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 40, 4: 291} {0: 1, 1: 0, 2: 3, 3: 19, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!